motB [2017-11-08 10:10:01]

H⁺-coupled MotA-MotB flagellar stator

Locus: BSU13680

Isoelectric point: 6.65

Molecular weight: 29.33 kDa

Protein length: 261 aa

Gene length: 783 bp

Function: Motility and chemotaxis

Product: flagellar stator subunit

Essential: no

Synonyms: mot

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → Genetic competence
• Lifestyles → Exponential and early post-exponential lifestyles → Motility and chemotaxis → Flagellar proteins
• Lifestyles → Exponential and early post-exponential lifestyles → Genetic competence
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,433,676 → 1,434,461

Phenotypes of a mutant

• increased DegU-P formation, resulting in reduced comK expression and strongly reduced genetic competence PubMed
• loss of swimming and swarming motility PubMed
• mucoid phenotype due to the DegU-P activated overexpression of the capB-capC-capA-capE operon and resulting overproduction of poly-gamma-glutamate PubMed

The protein

Protein family

• OmpA-like domain (according to Swiss-Prot)

Paralogous protein(s)

• MotS

Modification

• protonation of Asp-24 is essential for torque generation PubMed

Expression and Regulation

Operons

• Genes: motA-motB
  Description: PubMed

  Sigma factors

  • SigD: sigma factor, PubMed, in SigD regulon

Biological materials

Mutant

• available in [[Nicola Stanley-Wall]]'s lab PubMed
• BKE13680 (ΔmotB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCTCATGCTTCTTCTTCTTT, downstream forward: _UP4_TAGCAAAAAAGGAAGCCTTG
• BKK13680 (ΔmotB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCTCATGCTTCTTCTTCTTT, downstream forward: _UP4_TAGCAAAAAAGGAAGCCTTG

References

Loading